FR008611
ID FR008611
Second Structure image
[PDF]
Accession AC055752,AF389851
Description U6 spliceosomal RNA
SO name U6_snRNA
Organism Homo sapiens
Xref RF00026 Rfam v8.1
Length 100
Sequence
TCACTTCAGCAGTACATACACTAAAATTAAAACAATACAGAGATTAGCATGGCCCATGTG
CAAGGATGACATGCAAATTCGTGAAGTGTTCCATATTTTT