FR131272
ID FR131272
Second Structure image
[PDF]
Accession -
Description precursor micro RNA (miRNA) mir-499
SO name pre_miRNA
Organism Homo sapiens
Xref MI0003183 miRBase v9.2
Length 122
Sequence
GCCCTGTCCCCTGTGCCTTGGGCGGGCGGCTGTTAAGACTTGCAGTGATGTTTAACTCCT
CTCCACGTGAACATCACAGCAAGTCTGTGCTGCTTCCCGTCCCTACGCTGCCTGGGCAGG
GT