FR164966
ID FR164966
Second Structure -
Accession -
Description Putative conserved noncoding region (RNAz)
SO name nc_conserved_region
Organism Homo sapiens
Xref RNZ2796 RNAdb v2.0
Length 197
Sequence
GTGTATATGTTGGTTTAATTAATAATATGTACTAAGAATGTCCTTATTCTTGTGGTTAAA
AACCTGCCTAAATTAAATTGGGCTTCAATCACTGTAACCTGATTCATCCTGGGATGTAAA
CCATTCGAAGTCAGCTAATTGGACTTTTATGGCTCTATCTTTTCCTTCAGTGAAGAACCC
TATTTAAAACTGGGTCA