FR184857
ID FR184857
Second Structure image
[PDF]
Accession DQ584642
Description Piwi-interacting RNA (piRNA)
SO name piRNA
Organism Homo sapiens
Xref PIR45753 RNAdb v2.0
Length 30
Sequence
TGCCCAGAGGTAGAAGAGGGTGTTGGAAAC