FR189979
ID FR189979
Second Structure image
[PDF]
Accession AL355608
Description H/ACA box guide small nucleolar RNA (snoRNA) SNORA70 / U70
SO name H_ACA_box_snoRNA
Organism Homo sapiens
Xref RF00156 Rfam v8.1
Length 135
Sequence
CTGCAGCCAATTAAGCCAACTGGGTTCCTTTCCTCATGGGGGCCCATTGTGCAATGGCTG
CAAACAGCAGCTTTCTTGGTAGTGTATGCAGCCTGTTTGTTGTATGGGTTGCTTTAAGGG
ACCATGGAAACAGGC