FR232152
ID FR232152
Second Structure image
[PDF]
Accession AF141346,AL136170,AL591203,BC038733
Description C/D box guide small nucleolar RNA (snoRNA) J17 / R15 / R60 / Z193 / Z230
SO name C_D_box_snoRNA
Organism Homo sapiens
Xref RF00309 Rfam v8.1
Length 82
Sequence
CCGATACAATGATGATAACATAGTTCAGCAGACTAACGCTGATGAGCAATATTAAGTCTT
TCGCTCCTATCTGATGTATCTG