FR309007
ID FR309007
Second Structure image
[PDF]
Accession -
Description precursor micro RNA (miRNA) mir-620
SO name pre_miRNA
Organism Homo sapiens
Xref MI0003634 miRBase v9.2
Length 95
Sequence
ATATATATCTATATCTAGCTCCGTATATATATATATATATATATAGATATCTCCATATAT
ATGGAGATAGATATAGAAATAAAACAAGCAAAGAA