FR351493
ID FR351493
Second Structure image
[PDF]
Accession NR_003221
Description C/D box small nucleolar RNA (snoRNA) 14q(II-28) / SNORD114-28
SO name C_D_box_snoRNA
Organism Homo sapiens
Xref SNO1255 RNAdb v2.0,14q(II-28) snoRNA-LBME-db release3
Length 71
Sequence
TGGATCGATGATGACTGCTGGTGGCGTATGAGTCATATGCGATGAATACGTGTCTAGAAC
TCTGAGGTCCA