| FY038949 | |
| Accession Number | FY038949 |
| Clone Name | rbmte19i07 |
| Length | 755 |
| GO check_date | - |
| GO Iprscan Value | |
| GO ID | - |
| NR blast_date | 11/11/04 |
| NR value | 42 %/217 aa |
| NR definition | ref|XP_002431927.1| conserved hypothetical protein [Pediculus humanus corporis] gb|EEB19189.1| conserved hypothetical protein [Pediculus humanus corporis] |
| Drosophila blast_date | 11/11/04 |
| Drosophila value | n.h |
| Drosophila definition | - |
| C.elegans blast_date | 11/11/04 |
| C.elegans value | n.h |
| C.elegans definition | - |
| Anopheles blast_date | 11/11/04 |
| Anopheles value | low homology |
| Anopheles definition | - |
| Apis blast_date | 11/11/04 |
| Apis value | 39 %/224 aa |
| Apis definition | gnl|Amel|GB14311-PA |
| Tribolium blast_date | 11/11/04 |
| Tribolium value | 38 %/237 aa |
| Tribolium definition | gi|91078946|ref|XP_974065.1| PREDICTED: similar to Outer dense fiber protein 2 (Outer dense fiber of sperm tails protein 2) (84 kDa outer dense fiber protein) (Cenexin) [Tribolium castaneum] |
| Cluster Size | 24 |
| Rep ID | FS892927 |
| cDNA library name | bmte |
| Sequence | ataatgaaatcgaaaagttgatacatttaaccgttaaagtttcagggattatcgaaaaag tttttacaggtgcactcctgattctctccgtcgccgtctccggtgctagaagccgtcctc ctgagggactgcacctgcgtctgcagaccgaggatccggagctgggcctgctcgaagttc tccgtcagacgcttcatttgccagtgcaatcggtttttcagctcttcccgttccttctcg gcggtgctgacttgtgccctggaggccgccagctgtcgttccagctctgctaccgtggtt tggaggcacttccgcacagtttccgtttgctcgtgggctctctgcagcgcccgcgaggcc tcgtccctggtgcggtccaactctcccccaagctgggcacattcgtgcatcttctcttga agccgcttctcattagctaatgcagattcttcagttctgatcacgctggctttgagtctt tctatttcactctttaagctgatgttattctccgcgagttgtgatattctctggttaaga agtgccatttgtttctcgtccccaccgcgttccggaggtttttccgggggcttcaggcta ttatgtagcaacacgtgaaccttctcccgtgcgcagttgagctccctagcgagctgctct gcgttgtgctcagcgatggcctgcgcttgctgagcgtccttcagcctcatctgagtcgct ttcaacagatcggggatcggagccaactcttggag |