FY038949 | |
Accession Number | FY038949 |
Clone Name | rbmte19i07 |
Length | 755 |
GO check_date | - |
GO Iprscan Value | |
GO ID | - |
NR blast_date | 11/11/04 |
NR value | 42 %/217 aa |
NR definition | ref|XP_002431927.1| conserved hypothetical protein [Pediculus humanus corporis] gb|EEB19189.1| conserved hypothetical protein [Pediculus humanus corporis] |
Drosophila blast_date | 11/11/04 |
Drosophila value | n.h |
Drosophila definition | - |
C.elegans blast_date | 11/11/04 |
C.elegans value | n.h |
C.elegans definition | - |
Anopheles blast_date | 11/11/04 |
Anopheles value | low homology |
Anopheles definition | - |
Apis blast_date | 11/11/04 |
Apis value | 39 %/224 aa |
Apis definition | gnl|Amel|GB14311-PA |
Tribolium blast_date | 11/11/04 |
Tribolium value | 38 %/237 aa |
Tribolium definition | gi|91078946|ref|XP_974065.1| PREDICTED: similar to Outer dense fiber protein 2 (Outer dense fiber of sperm tails protein 2) (84 kDa outer dense fiber protein) (Cenexin) [Tribolium castaneum] |
Cluster Size | 24 |
Rep ID | FS892927 |
cDNA library name | bmte |
Sequence | ataatgaaatcgaaaagttgatacatttaaccgttaaagtttcagggattatcgaaaaag tttttacaggtgcactcctgattctctccgtcgccgtctccggtgctagaagccgtcctc ctgagggactgcacctgcgtctgcagaccgaggatccggagctgggcctgctcgaagttc tccgtcagacgcttcatttgccagtgcaatcggtttttcagctcttcccgttccttctcg gcggtgctgacttgtgccctggaggccgccagctgtcgttccagctctgctaccgtggtt tggaggcacttccgcacagtttccgtttgctcgtgggctctctgcagcgcccgcgaggcc tcgtccctggtgcggtccaactctcccccaagctgggcacattcgtgcatcttctcttga agccgcttctcattagctaatgcagattcttcagttctgatcacgctggctttgagtctt tctatttcactctttaagctgatgttattctccgcgagttgtgatattctctggttaaga agtgccatttgtttctcgtccccaccgcgttccggaggtttttccgggggcttcaggcta ttatgtagcaacacgtgaaccttctcccgtgcgcagttgagctccctagcgagctgctct gcgttgtgctcagcgatggcctgcgcttgctgagcgtccttcagcctcatctgagtcgct ttcaacagatcggggatcggagccaactcttggag |