| 851 | |
| id | 851 |
| QTL/Gene | xa5 |
| Major category | Resistance or Tolerance |
| Category of object character | Bacterial blight resistance |
| Character | resistant or susceptible phenotype |
| Marker | - |
| No. of marker for position determination | 2 |
| Chr | 5 |
| Genome start | 347741 |
| Genome end | 491988 |
| Mapping method | A)Physical |
| Population | F2 |
| No. of plants | 22000 |
| LOD | - |
| Parent A | Nipponbare |
| Parent B | IRBB5 |
| Direction (Parent) | - |
| a) Physical | AC129716, AC079022, and 44B4." |
| b) Fine1; interval | K8(ctacagagaactaatcaacc, ctcgatttcttacaatgtcc)" |
| b) Fine2; interval | T25 (tccagtcgaaaggtcttcac,ttgcagactcgcagttactc)" |
| b) Fine3; co-segregated | - |
| c) Interval1; interval | - |
| c) Interval2; interval | - |
| c) Interval3; co-segregated | - |
| d) Co-segregated | - |
| Explained variance | - |
| Additive effect | - |
| Year | 2006 |
| Reference Source | pha |
| Reference no. | 734 |
| Reference | Jiang, G.H., Xia, Z.H., Zhou, Y.L., Wan, J., Li, D.Y., Chen, R.S., Zhai, W.X., and Zhu, L.H. (2006). Testifying the rice bacterial blight resistance gene xa5 by genetic complementation and further analyzing xa5 (Xa5) in comparison with its homolog TFIIAgamma1. Mol Genet Genomics 275, 354-366. |
| Reference location | http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=16614777 |