| 5598 | |
| Element No(Glass) | 5598 |
| Clone name | FE0164 |
| Accession_01 | AU174642 |
| Accession_02 | - |
| Locus name | - |
| Chr type | - |
| EST cluster type | - |
| Availability | true |
| 3'UTR M /no check | - |
| Full insert M /no check | no |
| Destination Plate | DPlate 058 |
| Dplate Pos | F04 |
| Mapped 3'UTR Primer seq (Upper) | |
| Mapped 3'UTR Primer seq (Lower) | |
| Unmapped 3'UTR Primer seq (Upper) | CCTTCCTCGGCCCCCTCTGC |
| Unmapped 3'UTR Primer seq (Lower) | AAGTGCTCGCGCTGTTCCTG |
| Putative Identification | >LEEXTEN5_1(X55685|pid:g1345537) Tomato extensin mRNA (clone uG-18); Protein sequence is in conflict with the conceptual translation; ORF. &S14974(S14974) |