| 5872 | |
| Element No(Glass) | 5872 |
| Clone name | RA0286 |
| Accession_01 | D23831 |
| Accession_02 | AU164531 |
| Locus name | - |
| Chr type | - |
| EST cluster type | - |
| Availability | true |
| 3'UTR M /no check | - |
| Full insert M /no check | - |
| Destination Plate | DPlate 061 |
| Dplate Pos | H02 |
| Mapped 3'UTR Primer seq (Upper) | |
| Mapped 3'UTR Primer seq (Lower) | |
| Unmapped 3'UTR Primer seq (Upper) | TCGTGCACGCCGACGCGGTC |
| Unmapped 3'UTR Primer seq (Lower) | TTGGTGAGGAAGTTGGCCTC |
| Putative Identification | >AC002329_18(AC002329|pid:g2262173) DNA sequence of Arabidopsis thaliana BAC F5J6 from chromosome IV, complete sequence; signature for active site of class II pyridine nucleotide-disulphide oxidoreductases located from residues 197 to 219 [CAVCD...IGGGD]. |