| 5888 | |
| Element No(Glass) | 5888 |
| Clone name | RA0369 |
| Accession_01 | AU173086 |
| Accession_02 | AU173087 |
| Locus name | - |
| Chr type | - |
| EST cluster type | - |
| Availability | true |
| 3'UTR M /no check | - |
| Full insert M /no check | - |
| Destination Plate | DPlate 061 |
| Dplate Pos | H04 |
| Mapped 3'UTR Primer seq (Upper) | |
| Mapped 3'UTR Primer seq (Lower) | |
| Unmapped 3'UTR Primer seq (Upper) | ACAGCATCCCCACCTTCGTC |
| Unmapped 3'UTR Primer seq (Lower) | GATGCGACGACAGATTGGTC |
| Putative Identification | >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thaliana DNA chromosome 4, BAC clone F18F4 (ESSAII project); Protein sequence is in conflict with the conceptual translation; 5-substituted hydantoins to the corresponding L-amino acids, Pseudomonas sp., PIR2:D42594; contains EST gb:T45208. |