| 7463 | |
| Element No(Glass) | 7463 |
| Clone name | SA0655 |
| Accession_01 | AU162697 |
| Accession_02 | AU056522 |
| Locus name | S20655 |
| Chr type | 1 |
| EST cluster type | G |
| Availability | true |
| 3'UTR M /no check | - |
| Full insert M /no check | - |
| Destination Plate | DPlate 076 |
| Dplate Pos | G09 |
| Mapped 3'UTR Primer seq (Upper) | |
| Mapped 3'UTR Primer seq (Lower) | |
| Unmapped 3'UTR Primer seq (Upper) | TAATTCCACGCTTTTTCCTC |
| Unmapped 3'UTR Primer seq (Lower) | TTTCCTGTTTCTGTTTCTTC |
| Putative Identification | >ATATAF1_1(X74755|pid:g1345506) A.thaliana ATAF1 mRNA; Protein sequence is in conflict with the conceptual translation.. &S37101(S37101) |