BP911490 | |
Clone id | YMU001_000005_E11 |
Library | YMU01 |
Length | 550 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000005_E11. |
Accession | BP911490 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL1859Contig1 |
Sequence | GATAGACAATGATGGCCAACAGTGGATACAAGTCTTGGGGAAATCCTCACTGCACGATGT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q54M20 |
Definition | sp|Q54M20|TTC4_DICDI Tetratricopeptide repeat protein 4 homolog OS=Dictyostelium discoideum |
Align length | 43 |
Score (bit) | 43.5 |
E-value | 0.0007 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A7Q1I4 |
Definition | tr|A7Q1I4|A7Q1I4_VITVI Chromosome chr7 scaffold_44, whole genome shotgun sequence OS=Vitis vinifera |
Align length | 46 |
Score (bit) | 57.0 |
E-value | 6.0e-07 |
Report | BLASTX 2.2.19 [Nov-02-2008] |