| BP911490 | |
| Clone id | YMU001_000005_E11 |
| Library | YMU01 |
| Length | 550 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000005_E11. |
| Accession | BP911490 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL1859Contig1 |
| Sequence | GATAGACAATGATGGCCAACAGTGGATACAAGTCTTGGGGAAATCCTCACTGCACGATGT |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q54M20 |
| Definition | sp|Q54M20|TTC4_DICDI Tetratricopeptide repeat protein 4 homolog OS=Dictyostelium discoideum |
| Align length | 43 |
| Score (bit) | 43.5 |
| E-value | 0.0007 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A7Q1I4 |
| Definition | tr|A7Q1I4|A7Q1I4_VITVI Chromosome chr7 scaffold_44, whole genome shotgun sequence OS=Vitis vinifera |
| Align length | 46 |
| Score (bit) | 57.0 |
| E-value | 6.0e-07 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |