BP911694 | |
Clone id | YMU001_000008_B01 |
Library | YMU01 |
Length | 497 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000008_B01. |
Accession | BP911694 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL1719Contig1 |
Sequence | CCAGGGCCAGGTAGGCTCTGAAGTCCAAAATGAGAGGTCTACTGTTGTAGGGACTAAAGA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q4S887 |
Definition | tr|Q4S887|Q4S887_TETNG Chromosome 3 SCAF14707, whole genome shotgun sequence. (Fragment) OS=Tetraodon nigroviridis |
Align length | 104 |
Score (bit) | 37.0 |
E-value | 0.52 |
Report | BLASTX 2.2.19 [Nov-02-2008] |