BP911850 | |
Clone id | YMU001_000009_H06 |
Library | YMU01 |
Length | 221 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000009_H06. |
Accession | BP911850 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL10Contig1 |
Sequence | GCTTGATCAGTGAGCTATTACGCACTCTTTCAAGGGTTGGTGCTTCTAGGCAAACCTCCT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A6N1H4 |
Definition | tr|A6N1H4|A6N1H4_ORYSI Retrotransposon protein OS=Oryza sativa subsp. indica |
Align length | 39 |
Score (bit) | 74.3 |
E-value | 2.0e-15 |
Report | BLASTX 2.2.19 [Nov-02-2008] |