| BP911850 | |
| Clone id | YMU001_000009_H06 |
| Library | YMU01 |
| Length | 221 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000009_H06. |
| Accession | BP911850 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL10Contig1 |
| Sequence | GCTTGATCAGTGAGCTATTACGCACTCTTTCAAGGGTTGGTGCTTCTAGGCAAACCTCCT |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | - |
| Definition | No hits. |
| Align length | - |
| Score (bit) | - |
| E-value | - |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A6N1H4 |
| Definition | tr|A6N1H4|A6N1H4_ORYSI Retrotransposon protein OS=Oryza sativa subsp. indica |
| Align length | 39 |
| Score (bit) | 74.3 |
| E-value | 2.0e-15 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |