BP911940 |
Clone id |
YMU001_000011_A08 |
Library |
YMU01 |
Length |
131 |
Definition |
Adiantum capillus-veneris mRNA. clone: YMU001_000011_A08. |
Accession |
BP911940 |
Tissue type |
prothallium |
Developmental stage |
- |
Contig ID |
- |
Sequence |
CAAATCGGCAGAGCACTATGCGAAGTTGGCGGAAATACAGTGCAAAAGAAAATTCAAAAA CTTATGAAGAACTTCTAGCAAACAAAAGGCTTTGGAAGAAGTGGCACATCGAAAGTGACG AGTACGATGAA |
■■Homology search results ■■ |
- |
Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
sp_hit_id |
Q55C24 |
Definition |
sp|Q55C24|NHP6_DICDI Non-histone chromosomal protein 6 homolog OS=Dictyostelium discoideum |
Align length |
37 |
Score (bit) |
32.0 |
E-value |
0.98 |
Report |
|
TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
tr_hit_id |
A9TD19 |
Definition |
tr|A9TD19|A9TD19_PHYPA Predicted protein OS=Physcomitrella patens subsp. patens |
Align length |
29 |
Score (bit) |
36.6 |
E-value |
0.64 |
Report |
|