| BP911940 |
| Clone id |
YMU001_000011_A08 |
| Library |
YMU01 |
| Length |
131 |
| Definition |
Adiantum capillus-veneris mRNA. clone: YMU001_000011_A08. |
| Accession |
BP911940 |
| Tissue type |
prothallium |
| Developmental stage |
- |
| Contig ID |
- |
| Sequence |
CAAATCGGCAGAGCACTATGCGAAGTTGGCGGAAATACAGTGCAAAAGAAAATTCAAAAA CTTATGAAGAACTTCTAGCAAACAAAAGGCTTTGGAAGAAGTGGCACATCGAAAGTGACG AGTACGATGAA |
| ■■Homology search results ■■ |
- |
| Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
| sp_hit_id |
Q55C24 |
| Definition |
sp|Q55C24|NHP6_DICDI Non-histone chromosomal protein 6 homolog OS=Dictyostelium discoideum |
| Align length |
37 |
| Score (bit) |
32.0 |
| E-value |
0.98 |
| Report |
 |
| TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
| tr_hit_id |
A9TD19 |
| Definition |
tr|A9TD19|A9TD19_PHYPA Predicted protein OS=Physcomitrella patens subsp. patens |
| Align length |
29 |
| Score (bit) |
36.6 |
| E-value |
0.64 |
| Report |
 |