BP911944
Clone id YMU001_000011_B04
Library
Length 162
Definition Adiantum capillus-veneris mRNA. clone: YMU001_000011_B04.
Accession
Tissue type prothallium
Developmental stage -
Contig ID -
Sequence
GAATAGCTTCTCAACATGCCAGACAAACAGCCAGATTTAACCATGTGCTTAAGTTATGGA
TACCTATTGTAGAAATGGGCTGCTTCGAGAAATGCATCAAGTAGTGCTTTTTATTCCTTA
ACTGCTCGTCAGAACTGTAATAACCACGTTTACGGACACTCC
■■Homology search results ■■ -
sp_hit_id -
Definition No hits.
Align length -
Score (bit) -
E-value -
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP911944|Adiantum capillus-veneris mRNA, clone:
YMU001_000011_B04.
(162 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done

***** No hits found ******


tr_hit_id -
Definition No hits.
Align length -
Score (bit) -
E-value -
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP911944|Adiantum capillus-veneris mRNA, clone:
YMU001_000011_B04.
(162 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done

***** No hits found ******