| BP912183 | |
| Clone id | YMU001_000016_B03 |
| Library | YMU01 |
| Length | 208 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000016_B03. |
| Accession | BP912183 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | CTCCAACTAGTCTAAATGATACCTTTGCATAGCTATAAGCTTCCCAACAGAATGGTTCTT |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | P96722 |
| Definition | sp|P96722|YWQJ_BACSU UPF0720 protein ywqJ OS=Bacillus subtilis |
| Align length | 48 |
| Score (bit) | 29.6 |
| E-value | 4.9 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | Q9SKT8 |
| Definition | tr|Q9SKT8|Q9SKT8_ARATH Putative uncharacterized protein At2g20790 OS=Arabidopsis thaliana |
| Align length | 59 |
| Score (bit) | 58.2 |
| E-value | 2.0e-07 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |