BP912183 | |
Clone id | YMU001_000016_B03 |
Library | YMU01 |
Length | 208 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000016_B03. |
Accession | BP912183 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | CTCCAACTAGTCTAAATGATACCTTTGCATAGCTATAAGCTTCCCAACAGAATGGTTCTT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | P96722 |
Definition | sp|P96722|YWQJ_BACSU UPF0720 protein ywqJ OS=Bacillus subtilis |
Align length | 48 |
Score (bit) | 29.6 |
E-value | 4.9 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q9SKT8 |
Definition | tr|Q9SKT8|Q9SKT8_ARATH Putative uncharacterized protein At2g20790 OS=Arabidopsis thaliana |
Align length | 59 |
Score (bit) | 58.2 |
E-value | 2.0e-07 |
Report | BLASTX 2.2.19 [Nov-02-2008] |