| BP912269 |
| Clone id |
YMU001_000017_A12 |
| Library |
YMU01 |
| Length |
113 |
| Definition |
Adiantum capillus-veneris mRNA. clone: YMU001_000017_A12. |
| Accession |
BP912269 |
| Tissue type |
prothallium |
| Developmental stage |
- |
| Contig ID |
CL1532Contig1 |
| Sequence |
CATAAGTCTGGATATTGTGTAAATCAGCTTGCTGGCCCCATTCAAGCTTAGCCACCGAAA CTTTGTTCACAAGATTGTGTTTTAAAACATTCTGATTCAACAGAGGGAGGTTT |
| ■■Homology search results ■■ |
- |
| Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
| sp_hit_id |
P29928 |
| Definition |
sp|P29928|SUMT_BACME Uroporphyrinogen-III C-methyltransferase OS=Bacillus megaterium |
| Align length |
34 |
| Score (bit) |
29.3 |
| E-value |
6.5 |
| Report |
 |
| TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
| tr_hit_id |
B0CRW5 |
| Definition |
tr|B0CRW5|B0CRW5_LACBS Predicted protein OS=Laccaria bicolor (strain S238N-H82) |
| Align length |
25 |
| Score (bit) |
32.7 |
| E-value |
9.4 |
| Report |
 |