| BP912350 | |
| Clone id | YMU001_000018_A12 |
| Library | YMU01 |
| Length | 515 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000018_A12. |
| Accession | BP912350 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | GAAGAATTCGCGGCCGCAGGAATTGATTGTATCAGAGGTGAGTAATCTTCTTCATCATGG |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q2QI47 |
| Definition | sp|Q2QI47|USH2A_MOUSE Usherin OS=Mus musculus |
| Align length | 43 |
| Score (bit) | 30.4 |
| E-value | 4.5 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | Q73YW4 |
| Definition | tr|Q73YW4|Q73YW4_MYCPA Putative uncharacterized protein OS=Mycobacterium paratuberculosis |
| Align length | 38 |
| Score (bit) | 35.0 |
| E-value | 1.9 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |