| BP912439 | |
| Clone id | YMU001_000019_E11 |
| Library | YMU01 |
| Length | 636 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000019_E11. |
| Accession | BP912439 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | AATTATACCACCTTTGTATTGACATAATTTCTAGTGTCTTTTGTAATTTGAAAGGATTCT |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q6EAL8 |
| Definition | sp|Q6EAL8|IL31_MOUSE Interleukin-31 OS=Mus musculus |
| Align length | 46 |
| Score (bit) | 35.0 |
| E-value | 0.33 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A4H5Q6 |
| Definition | tr|A4H5Q6|A4H5Q6_LEIBR Acyl-CoA binding protein, putative OS=Leishmania braziliensis |
| Align length | 59 |
| Score (bit) | 38.9 |
| E-value | 0.26 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |