BP912439 | |
Clone id | YMU001_000019_E11 |
Library | YMU01 |
Length | 636 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000019_E11. |
Accession | BP912439 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | AATTATACCACCTTTGTATTGACATAATTTCTAGTGTCTTTTGTAATTTGAAAGGATTCT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q6EAL8 |
Definition | sp|Q6EAL8|IL31_MOUSE Interleukin-31 OS=Mus musculus |
Align length | 46 |
Score (bit) | 35.0 |
E-value | 0.33 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A4H5Q6 |
Definition | tr|A4H5Q6|A4H5Q6_LEIBR Acyl-CoA binding protein, putative OS=Leishmania braziliensis |
Align length | 59 |
Score (bit) | 38.9 |
E-value | 0.26 |
Report | BLASTX 2.2.19 [Nov-02-2008] |