| BP912494 | |
| Clone id | YMU001_000019_B07 |
| Library | YMU01 |
| Length | 570 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000019_B07. |
| Accession | BP912494 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | GAGTGCAGATCCCCATACCTTTAAACACTAGAATGTCTACTGGGTCCAAGGCCCCATTGC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q978Z2 |
| Definition | sp|Q978Z2|RS3A_THEVO 30S ribosomal protein S3Ae OS=Thermoplasma volcanium |
| Align length | 81 |
| Score (bit) | 33.1 |
| E-value | 0.99 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | B8B5R2 |
| Definition | tr|B8B5R2|B8B5R2_ORYSI Putative uncharacterized protein OS=Oryza sativa subsp. indica |
| Align length | 148 |
| Score (bit) | 153.0 |
| E-value | 7.0e-36 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |