| BP912651 | |
| Clone id | YMU001_000021_D01 |
| Library | YMU01 |
| Length | 531 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000021_D01. |
| Accession | BP912651 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | ACAACCACAAACCTATCTTTCTTCAAGAAATCAGGGGGCATTTGATTCTCTTCAAGTCCC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q8TDI0 |
| Definition | sp|Q8TDI0|CHD5_HUMAN Chromodomain-helicase-DNA-binding protein 5 OS=Homo sapiens |
| Align length | 80 |
| Score (bit) | 33.1 |
| E-value | 0.85 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A9RQ41 |
| Definition | tr|A9RQ41|A9RQ41_PHYPA Predicted protein OS=Physcomitrella patens subsp. patens |
| Align length | 149 |
| Score (bit) | 44.7 |
| E-value | 0.003 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |