| BP912806 |
| Clone id |
YMU001_000023_A12 |
| Library |
YMU01 |
| Length |
145 |
| Definition |
Adiantum capillus-veneris mRNA. clone: YMU001_000023_A12. |
| Accession |
BP912806 |
| Tissue type |
prothallium |
| Developmental stage |
- |
| Contig ID |
CL28Contig1 |
| Sequence |
AATTACAACCTTAGAAATGGTGAATTTAAATGCCCTTGCAGTCCATAGCCAGATTTGGGA ATCACATGCAACTGCATCACGCAATGATGAGCCAACTCCACCGAAGCAATCTGGGGAGAA TTGGCACAGCATGGCGTCGTCACAC |
| ■■Homology search results ■■ |
- |
| Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
| sp_hit_id |
Q0VA04 |
| Definition |
sp|Q0VA04|CQ071_XENTR UPF0487 protein C17orf71 homolog OS=Xenopus tropicalis |
| Align length |
25 |
| Score (bit) |
29.6 |
| E-value |
4.8 |
| Report |
 |
| TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
| tr_hit_id |
- |
| Definition |
No hits. |
| Align length |
- |
| Score (bit) |
- |
| E-value |
- |
| Report |
 |