BP912979
Clone id YMU001_000025_A06
Library
Length 54
Definition Adiantum capillus-veneris mRNA. clone: YMU001_000025_A06.
Accession
Tissue type prothallium
Developmental stage -
Contig ID -
Sequence
TCTTCTTCTCTTTCTTCTTCTTGATCCTCCTTGCTCCTACCGTCACCTGCTCGG
■■Homology search results ■■ -
sp_hit_id -
Definition -
Align length -
Score (bit) -
E-value -
Report -
tr_hit_id -
Definition -
Align length -
Score (bit) -
E-value -
Report -