| BP912986 |
| Clone id |
YMU001_000025_B01 |
| Library |
YMU01 |
| Length |
207 |
| Definition |
Adiantum capillus-veneris mRNA. clone: YMU001_000025_B01. |
| Accession |
BP912986 |
| Tissue type |
prothallium |
| Developmental stage |
- |
| Contig ID |
- |
| Sequence |
GTTACAAAATATGCCTGAAGGCAAAGTATAATGATAAACCATAGATGGAAAAAACCCCTG AAGATTGTCAAGCATTACAAAGCTGAGGGGAAAAATCTAGGGCTCAATACAGGATAAATG ATACATGTAAATGTGATGGAGGAAAAAACCAAGAGACGAATGCTTGCAGAGAAGAAAGAT CTGAAGAATCACAACCTGTGAATTCCC |
| ■■Homology search results ■■ |
- |
| Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
| sp_hit_id |
P31332 |
| Definition |
sp|P31332|L_SYNV Large structural protein OS=Sonchus yellow net virus |
| Align length |
32 |
| Score (bit) |
29.3 |
| E-value |
6.4 |
| Report |
 |
| TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
| tr_hit_id |
B7GEL4 |
| Definition |
tr|B7GEL4|B7GEL4_PHATR Predicted protein OS=Phaeodactylum tricornutum CCAP 1055/1 |
| Align length |
53 |
| Score (bit) |
33.1 |
| E-value |
7.0 |
| Report |
 |