BP913061
Clone id YMU001_000026_A09
Library
Length 450
Definition Adiantum capillus-veneris mRNA. clone: YMU001_000026_A09.
Accession
Tissue type prothallium
Developmental stage -
Contig ID -
Sequence
TACAATGCAAAACCAACCATTCCCCATAAGTAACATGGGTGAACAAGTAGCTTGTACTTT
AGCACACTTNGAGGGATCCATCTTGAAGGAATTTCAGTAAAATAGCCCCATACCATTTCA
TACAAACTTGCAATGCTGGCCTAAAAAAGGCACTATGAAAGTGTCTCTAACACATTCAGG
CAATGCTAGCTCCAAAAAGCTACTATTTGCATACTAGATGCATGCGGCGAAGCATGCAAC
TACCAAAAATCTTTCTGCCTTGGGCCACATACCCCATCTCAAAACATTAACCCAAGTTTG
AACTAACCATAAAATAACACCTCAAAATCCTTGAAAGTTCTGTATGCCATTGTTATGGTA
TGGATGGATCCCAGTTGGACAATGATTGTGACCGATGATAACCTCATACATCTCGAAATG
AGGGCTGTATGTCAATGCTTATGAGACATG
■■Homology search results ■■ -
sp_hit_id -
Definition No hits.
Align length -
Score (bit) -
E-value -
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP913061|Adiantum capillus-veneris mRNA, clone:
YMU001_000026_A09.
(450 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done

***** No hits found ******


tr_hit_id B5J4M8
Definition tr|B5J4M8|B5J4M8_9RHOB TRAP transporter, DctM subunit subfamily, putative OS=Octadecabacter antarcticus 307
Align length 40
Score (bit) 35.8
E-value 1.1
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP913061|Adiantum capillus-veneris mRNA, clone:
YMU001_000026_A09.
(450 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

tr|B5J4M8|B5J4M8_9RHOB TRAP transporter, DctM subunit subfamily,... 36 1.1

>tr|B5J4M8|B5J4M8_9RHOB TRAP transporter, DctM subunit subfamily,
putative OS=Octadecabacter antarcticus 307 GN=OA307_4041
PE=4 SV=1
Length = 671

Score = 35.8 bits (81), Expect = 1.1
Identities = 18/40 (45%), Positives = 25/40 (62%)
Frame = -2

Query: 140 ASIASLYEMVWGYFTEIPSRWIPXSVLKYKLLVHPCYLWG 21
A+I SLYE+V YF P+ W+ +V+ LV CYL+G
Sbjct: 53 ATIVSLYEIVMRYFFNAPTIWVHETVI---ALVAVCYLYG 89