| BP913073 | |
| Clone id | YMU001_000026_B12 |
| Library | YMU01 |
| Length | 252 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000026_B12. |
| Accession | BP913073 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | TCAAGTCTTGCAATTCATCCTTCCAAGGCATCTTCTAAATCATGTTGCATGCAGAATCCT |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q5TBA9 |
| Definition | sp|Q5TBA9|FRY_HUMAN Protein furry homolog OS=Homo sapiens |
| Align length | 49 |
| Score (bit) | 30.4 |
| E-value | 2.8 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A8IT18 |
| Definition | tr|A8IT18|A8IT18_CHLRE Predicted protein OS=Chlamydomonas reinhardtii |
| Align length | 31 |
| Score (bit) | 33.5 |
| E-value | 5.5 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |