BP913073 | |
Clone id | YMU001_000026_B12 |
Library | YMU01 |
Length | 252 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000026_B12. |
Accession | BP913073 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | TCAAGTCTTGCAATTCATCCTTCCAAGGCATCTTCTAAATCATGTTGCATGCAGAATCCT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q5TBA9 |
Definition | sp|Q5TBA9|FRY_HUMAN Protein furry homolog OS=Homo sapiens |
Align length | 49 |
Score (bit) | 30.4 |
E-value | 2.8 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A8IT18 |
Definition | tr|A8IT18|A8IT18_CHLRE Predicted protein OS=Chlamydomonas reinhardtii |
Align length | 31 |
Score (bit) | 33.5 |
E-value | 5.5 |
Report | BLASTX 2.2.19 [Nov-02-2008] |