BP913098 | |
Clone id | YMU001_000026_E01 |
Library | YMU01 |
Length | 519 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000026_E01. |
Accession | BP913098 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL3980Contig1 |
Sequence | GTAAGGAGAGGGTCTTTCATACTAGCTGATGATGCAAGCTCTTCCCATAAGCCTGAAGCC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | P20930 |
Definition | sp|P20930|FILA_HUMAN Filaggrin OS=Homo sapiens |
Align length | 108 |
Score (bit) | 29.6 |
E-value | 9.0 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | B4GES0 |
Definition | tr|B4GES0|B4GES0_DROPE GL21749 OS=Drosophila persimilis |
Align length | 118 |
Score (bit) | 33.9 |
E-value | 5.0 |
Report | BLASTX 2.2.19 [Nov-02-2008] |