| BP913098 | |
| Clone id | YMU001_000026_E01 |
| Library | YMU01 |
| Length | 519 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000026_E01. |
| Accession | BP913098 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL3980Contig1 |
| Sequence | GTAAGGAGAGGGTCTTTCATACTAGCTGATGATGCAAGCTCTTCCCATAAGCCTGAAGCC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | P20930 |
| Definition | sp|P20930|FILA_HUMAN Filaggrin OS=Homo sapiens |
| Align length | 108 |
| Score (bit) | 29.6 |
| E-value | 9.0 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | B4GES0 |
| Definition | tr|B4GES0|B4GES0_DROPE GL21749 OS=Drosophila persimilis |
| Align length | 118 |
| Score (bit) | 33.9 |
| E-value | 5.0 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |