BP913103 | |
Clone id | YMU001_000026_E06 |
Library | YMU01 |
Length | 556 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000026_E06. |
Accession | BP913103 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | TCTTGCTCAATGCATGTCGGTTACAAAACCAAGACTATGTCGTCTCATACCTCAGATACA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | P82198 |
Definition | sp|P82198|BGH3_MOUSE Transforming growth factor-beta-induced protein ig-h3 OS=Mus musculus |
Align length | 39 |
Score (bit) | 30.4 |
E-value | 6.0 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A5C540 |
Definition | tr|A5C540|A5C540_VITVI Putative uncharacterized protein OS=Vitis vinifera |
Align length | 63 |
Score (bit) | 40.0 |
E-value | 0.083 |
Report | BLASTX 2.2.19 [Nov-02-2008] |