| BP913103 | |
| Clone id | YMU001_000026_E06 |
| Library | YMU01 |
| Length | 556 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000026_E06. |
| Accession | BP913103 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | TCTTGCTCAATGCATGTCGGTTACAAAACCAAGACTATGTCGTCTCATACCTCAGATACA |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | P82198 |
| Definition | sp|P82198|BGH3_MOUSE Transforming growth factor-beta-induced protein ig-h3 OS=Mus musculus |
| Align length | 39 |
| Score (bit) | 30.4 |
| E-value | 6.0 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A5C540 |
| Definition | tr|A5C540|A5C540_VITVI Putative uncharacterized protein OS=Vitis vinifera |
| Align length | 63 |
| Score (bit) | 40.0 |
| E-value | 0.083 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |