BP913285 | |
Clone id | YMU001_000028_E12 |
Library | YMU01 |
Length | 563 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000028_E12. |
Accession | BP913285 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL3974Contig1 |
Sequence | TTGAGATATTACCTGCAGGTACTCACTCTGCTGGAAAAGCTGGCAGAAGACAGAAAGGGC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q9U3L8 |
Definition | tr|Q9U3L8|Q9U3L8_CAEEL Protein C47A4.2b, partially confirmed by transcript evidence OS=Caenorhabditis elegans |
Align length | 57 |
Score (bit) | 35.0 |
E-value | 2.8 |
Report | BLASTX 2.2.19 [Nov-02-2008] |