BP913320 | |
Clone id | YMU001_000029_A01 |
Library | YMU01 |
Length | 344 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000029_A01. |
Accession | BP913320 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL1546Contig1 |
Sequence | ACCACAAGATGATCCAAGATGGGCCTCGGGCTACGTTCTATGGGTTTTAAAGCTAGTAAA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | P13368 |
Definition | sp|P13368|7LESS_DROME Protein sevenless OS=Drosophila melanogaster |
Align length | 54 |
Score (bit) | 31.2 |
E-value | 1.7 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |