BP913586 | |
Clone id | YMU001_000031_H06 |
Library | YMU01 |
Length | 563 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000031_H06. |
Accession | BP913586 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | CGGTGAACCTTCAGCCCGCGACACCTCTCATTCCCATGTCGCCTCGCACACGTACGCTTT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q9P6Y2 |
Definition | sp|Q9P6Y2|SEN2_NEUCR Probable tRNA-splicing endonuclease subunit sen-2 OS=Neurospora crassa |
Align length | 73 |
Score (bit) | 30.4 |
E-value | 6.3 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A7PBY6 |
Definition | tr|A7PBY6|A7PBY6_VITVI Chromosome chr2 scaffold_11, whole genome shotgun sequence OS=Vitis vinifera |
Align length | 55 |
Score (bit) | 53.1 |
E-value | 1.0e-05 |
Report | BLASTX 2.2.19 [Nov-02-2008] |