BP913618
Clone id YMU001_000032_C07
Library
Length 611
Definition Adiantum capillus-veneris mRNA. clone: YMU001_000032_C07.
Accession
Tissue type prothallium
Developmental stage -
Contig ID
Sequence
CTGGAAGAATTCGCGGCCTTTTGAGATGATATGCCACAACCAAAAGGGCTCACTGCTTCC
TCAAGTTGGATCTGTGTTAAGCTAACAACCTATTCAACACACACAAGCAAAAATGTTGCT
TCATAGCAAAGGCCAACATGTTTGAAAAACTCACGCAAGTTATGTTAAGAACACATTAAC
TTGATGTGGTTCATAACGACCATGCTTACAAAACAGCTGAAAGTTACTCAATTGAAAGGC
TTTTGAACTCCTATTAAAACAAGGAACACGCCCAAATTCAATAACACTCGCGGTTACCTT
CCACTAATAACTATCAAAGGTTTCCCAATTTTTACACTATTGCGATGAACGGCCAATAGA
CAGCAGAGAACTGGGTAGCAACACACCCTTCCCCACACATCAACATTTCCACTGAGGCCT
AAGAGTAACTGTCTCGCATACGAACATGGAGGACAGAGAAGCCAATTGAAGCCTAGCACT
AAAAGGAGAAGTTAATTCAATCGGACAGTAACAATTGGGCATACGCATCATCGGACCACT
CGCATGAAAAGCATACCCTAGCTTGCCTTCACAGAAGAAACTAAGAATCCTCACCTCATG
AGATGATCTTT
■■Homology search results ■■ -
sp_hit_id P52386
Definition sp|P52386|UL24_HHV7J Protein U49 OS=Human herpesvirus 7 (strain JI)
Align length 47
Score (bit) 30.0
E-value 9.1
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP913618|Adiantum capillus-veneris mRNA, clone:
YMU001_000032_C07.
(593 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

sp|P52386|UL24_HHV7J Protein U49 OS=Human herpesvirus 7 (strain ... 30 9.1

>sp|P52386|UL24_HHV7J Protein U49 OS=Human herpesvirus 7 (strain JI)
GN=U49 PE=3 SV=1
Length = 239

Score = 30.0 bits (66), Expect = 9.1
Identities = 17/47 (36%), Positives = 25/47 (53%)
Frame = +1

Query: 25 KGLTASSSWICVKLTTYSTHTSKNVAS*QRPTCLKNSRKLC*EHINL 165
K L SS+++C T Y T K++ S PT N R+ C ++ NL
Sbjct: 161 KELQLSSTFLCNLFTKYQNDTVKSILSISNPT---NFRRACQKYSNL 204


tr_hit_id -
Definition No hits.
Align length -
Score (bit) -
E-value -
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP913618|Adiantum capillus-veneris mRNA, clone:
YMU001_000032_C07.
(593 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done

***** No hits found ******