| BP913666 | |
| Clone id | YMU001_000032_H07 |
| Library | YMU01 |
| Length | 258 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000032_H07. |
| Accession | BP913666 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL324Contig1 |
| Sequence | CATCTCAGAGCTCATCCTGTTCGGCCTCTAGCTCGTCATCTCCTCCTCGTTCCTCCGGGT |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | - |
| Definition | No hits. |
| Align length | - |
| Score (bit) | - |
| E-value | - |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A9PBZ2 |
| Definition | tr|A9PBZ2|A9PBZ2_POPTR Putative uncharacterized protein OS=Populus trichocarpa |
| Align length | 21 |
| Score (bit) | 44.3 |
| E-value | 0.003 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |