BP913826 | |
Clone id | YMU001_000035_G06 |
Library | YMU01 |
Length | 467 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000035_G06. |
Accession | BP913826 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL2638Contig1 |
Sequence | CGAGCAGAAGGAATATGTGGCTGTGGAACGGGTCCTTCGAGTGGTGTTCTTGGATCCCCA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q65SK3 |
Definition | sp|Q65SK3|SYS_MANSM Seryl-tRNA synthetase OS=Mannheimia succiniciproducens (strain MBEL55E) |
Align length | 65 |
Score (bit) | 29.3 |
E-value | 8.9 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | B6TP74 |
Definition | tr|B6TP74|B6TP74_MAIZE Structural molecule OS=Zea mays |
Align length | 83 |
Score (bit) | 69.7 |
E-value | 7.0e-11 |
Report | BLASTX 2.2.19 [Nov-02-2008] |