| BP913826 | |
| Clone id | YMU001_000035_G06 |
| Library | YMU01 |
| Length | 467 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000035_G06. |
| Accession | BP913826 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL2638Contig1 |
| Sequence | CGAGCAGAAGGAATATGTGGCTGTGGAACGGGTCCTTCGAGTGGTGTTCTTGGATCCCCA |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q65SK3 |
| Definition | sp|Q65SK3|SYS_MANSM Seryl-tRNA synthetase OS=Mannheimia succiniciproducens (strain MBEL55E) |
| Align length | 65 |
| Score (bit) | 29.3 |
| E-value | 8.9 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | B6TP74 |
| Definition | tr|B6TP74|B6TP74_MAIZE Structural molecule OS=Zea mays |
| Align length | 83 |
| Score (bit) | 69.7 |
| E-value | 7.0e-11 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |