BP913961 | |
Clone id | YMU001_000038_C11 |
Library | YMU01 |
Length | 617 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000038_C11. |
Accession | BP913961 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL2617Contig1 |
Sequence | CTGCAGGTACTCGGCTTCCCTTCTGGTGGTATGGAACCGAGTCTCACTATTCAGTAGCTG |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q9VTD4 |
Definition | tr|Q9VTD4|Q9VTD4_DROME Fad2 OS=Drosophila melanogaster |
Align length | 52 |
Score (bit) | 38.5 |
E-value | 0.32 |
Report | BLASTX 2.2.19 [Nov-02-2008] |