| BP913993 | |
| Clone id | YMU001_000038_F08 |
| Library | YMU01 |
| Length | 486 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000038_F08. |
| Accession | BP913993 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | GGTCTCCAATTTTGAGCTACGACGAGGAGGAATTGCCGTACAAAGGAGTACAAGAAAGGC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q66GS9 |
| Definition | sp|Q66GS9|CP135_HUMAN Centrosomal protein of 135 kDa OS=Homo sapiens |
| Align length | 44 |
| Score (bit) | 30.4 |
| E-value | 4.5 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | Q2SUT0 |
| Definition | tr|Q2SUT0|Q2SUT0_BURTA 3-hydroxyacyl-CoA dehydrogenase family protein OS=Burkholderia thailandensis (strain E264 / ATCC 700388 / DSM 13276 / CIP 106301) |
| Align length | 46 |
| Score (bit) | 35.4 |
| E-value | 1.4 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |