BP913993 | |
Clone id | YMU001_000038_F08 |
Library | YMU01 |
Length | 486 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000038_F08. |
Accession | BP913993 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | GGTCTCCAATTTTGAGCTACGACGAGGAGGAATTGCCGTACAAAGGAGTACAAGAAAGGC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q66GS9 |
Definition | sp|Q66GS9|CP135_HUMAN Centrosomal protein of 135 kDa OS=Homo sapiens |
Align length | 44 |
Score (bit) | 30.4 |
E-value | 4.5 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q2SUT0 |
Definition | tr|Q2SUT0|Q2SUT0_BURTA 3-hydroxyacyl-CoA dehydrogenase family protein OS=Burkholderia thailandensis (strain E264 / ATCC 700388 / DSM 13276 / CIP 106301) |
Align length | 46 |
Score (bit) | 35.4 |
E-value | 1.4 |
Report | BLASTX 2.2.19 [Nov-02-2008] |