BP914055 | |
Clone id | YMU001_000039_D03 |
Library | YMU01 |
Length | 379 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000039_D03. |
Accession | BP914055 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | AGTGGTGGTGGTGGTTGGTTGGTAGGTGATGGGGTCATTGAGTTGTCTAAGTGCCTCATT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q28FM0 |
Definition | tr|Q28FM0|Q28FM0_XENTR Novel protein OS=Xenopus tropicalis |
Align length | 46 |
Score (bit) | 36.2 |
E-value | 0.82 |
Report | BLASTX 2.2.19 [Nov-02-2008] |