BP914133
Clone id YMU001_000042_C04
Library
Length 507
Definition Adiantum capillus-veneris mRNA. clone: YMU001_000042_C04.
Accession
Tissue type prothallium
Developmental stage -
Contig ID -
Sequence
GTTGCAGGATTTTTAGTATACTTTTTGGTCATTTTTTTCTCATCTCCTGAATGATAATCA
GTCAATGGATGCTGAAGTGTCGTTCGAGAGTATGCTCGAGGAATGAATTTGAGATATAGA
GATCAAGTGTTGATGTTGGTCACCAAAGCATGAGATGCATCTCCGCCAACTTCCAGCAGT
GTCGAAGTCGCGGAAAACCATTTCCTGCCGCACATGTCTTTTACCAGCGGCTTTTTATTT
GATACTGCCTAACATAGAAGTCACATGTATGAATGAGAGCCCTCTTTCCCGTGTGATTTG
AAGCTCTTCGCTTTCTTGTAGCGGGAGAAGCATCTTTATGAAGCAACATAGTGGCTACCA
TCTCATGTTAGTGATAATATTCTTTGCCACTTTATAAGCAAGTGTGTGCAGGCTTGCTTC
TTTTTGTAGAGTGAATCAGAAACAGTTGTATTGCTAAGAGGCACATTCCACTGAGAATGG
CAGCTATACGGCAATGGTGCACTAAAG
■■Homology search results ■■ -
sp_hit_id -
Definition No hits.
Align length -
Score (bit) -
E-value -
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP914133|Adiantum capillus-veneris mRNA, clone:
YMU001_000042_C04.
(507 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done

***** No hits found ******


tr_hit_id O23465
Definition tr|O23465|O23465_ARATH Putative uncharacterized protein dl4125c OS=Arabidopsis thaliana
Align length 16
Score (bit) 35.4
E-value 1.6
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP914133|Adiantum capillus-veneris mRNA, clone:
YMU001_000042_C04.
(507 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

tr|O23465|O23465_ARATH Putative uncharacterized protein dl4125c ... 35 1.6
tr|A9TW23|A9TW23_PHYPA Predicted protein OS=Physcomitrella paten... 33 8.0
tr|A9T5S3|A9T5S3_PHYPA Predicted protein OS=Physcomitrella paten... 33 8.0

>tr|O23465|O23465_ARATH Putative uncharacterized protein dl4125c
OS=Arabidopsis thaliana GN=dl4125c PE=2 SV=1
Length = 429

Score = 35.4 bits (80), Expect = 1.6
Identities = 16/16 (100%), Positives = 16/16 (100%)
Frame = +1

Query: 1 VAGFLVYFLVIFFSSP 48
VAGFLVYFLVIFFSSP
Sbjct: 411 VAGFLVYFLVIFFSSP 426


>tr|A9TW23|A9TW23_PHYPA Predicted protein OS=Physcomitrella patens
subsp. patens GN=PHYPADRAFT_226015 PE=4 SV=1
Length = 437

Score = 33.1 bits (74), Expect = 8.0
Identities = 15/17 (88%), Positives = 16/17 (94%)
Frame = +1

Query: 1 VAGFLVYFLVIFFSSPE 51
VAGFLVYFLVI+FSS E
Sbjct: 420 VAGFLVYFLVIYFSSSE 436


>tr|A9T5S3|A9T5S3_PHYPA Predicted protein OS=Physcomitrella patens
subsp. patens GN=PHYPADRAFT_191923 PE=4 SV=1
Length = 436

Score = 33.1 bits (74), Expect = 8.0
Identities = 15/17 (88%), Positives = 16/17 (94%)
Frame = +1

Query: 1 VAGFLVYFLVIFFSSPE 51
VAGFLVYFLVI+FSS E
Sbjct: 419 VAGFLVYFLVIYFSSSE 435