BP914216
Clone id YMU001_000056_D06
Library
Length 549
Definition Adiantum capillus-veneris mRNA. clone: YMU001_000056_D06.
Accession
Tissue type prothallium
Developmental stage -
Contig ID
Sequence
CTCCAACAAGACTTGCACCTCCCCTGTCTGTGGAGTAGAAACAACCGTCCTCGCCTCAGT
CTTCTCTTTCTCGTACATTTTTTCCCATCCATCTGGCTTAATTTGTAACTCTTCAGCTTC
TTTTTTTGTCTTCCACTCTTCTTTCTTCTCCTCTGTGGATGCTTTTGCGATTTCTTGAGG
GGTTTGCGTGAATGTGAGCGCTGTCCCTCTTACCCACTCCTTCAACGGAACCTTTCTTTC
CATTGCAGTGCTTGTATCTGAATCACTCGCATTCGCACTTGATTGGAACACACAAAGGGT
TTTGACATCGTCAACTCGCTCTTCCTGCTCACTGTGTATCTGTTGTTGATCACCTTCTAC
TCCTATTGGTTCTTCTGTTCTTTGTTGATCTTTGGAGCACCCCTCCTTACCTTCCTCACT
ACCTTTTTCTTTGCTGACTTCTTTAGCTATCTGCATTGTTTCTTGACTCCTTTGAGGGCT
GGCCACGGGGGCAAAAGATGATTCTTCATCGTTCTTTGTTTCAAGCAATGCCTCAGCATG
AGTTCCGCT
■■Homology search results ■■ -
sp_hit_id O14512
Definition sp|O14512|SOCS7_HUMAN Suppressor of cytokine signaling 7 OS=Homo sapiens
Align length 27
Score (bit) 30.4
E-value 5.9
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP914216|Adiantum capillus-veneris mRNA, clone:
YMU001_000056_D06.
(549 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

sp|O14512|SOCS7_HUMAN Suppressor of cytokine signaling 7 OS=Homo... 30 5.9
sp|A2ALU4|SHRM2_MOUSE Protein Shroom2 OS=Mus musculus GN=Shroom2... 30 6.0
sp|Q8VHQ2|SOCS7_MOUSE Suppressor of cytokine signaling 7 OS=Mus ... 30 7.7

>sp|O14512|SOCS7_HUMAN Suppressor of cytokine signaling 7 OS=Homo
sapiens GN=SOCS7 PE=1 SV=2
Length = 581

Score = 30.4 bits (67), Expect = 5.9
Identities = 13/27 (48%), Positives = 16/27 (59%)
Frame = -3

Query: 262 FRYKHCNGKKGSVEGVGKRDSAHIHAN 182
FR K CNG G +G GKR S + A+
Sbjct: 218 FRTKSCNGGSGGGDGTGKRPSGELAAS 244


>sp|A2ALU4|SHRM2_MOUSE Protein Shroom2 OS=Mus musculus GN=Shroom2 PE=1
SV=1
Length = 1481

Score = 30.4 bits (67), Expect = 6.0
Identities = 16/29 (55%), Positives = 17/29 (58%)
Frame = -1

Query: 549 SGTHAEALLETKNDEESSFAPVASPQRSQ 463
SG H EA+L T EE AP A PQ SQ
Sbjct: 981 SGDHKEAILCTLQAEEGCSAPSAQPQDSQ 1009


>sp|Q8VHQ2|SOCS7_MOUSE Suppressor of cytokine signaling 7 OS=Mus
musculus GN=Socs7 PE=1 SV=1
Length = 579

Score = 30.0 bits (66), Expect = 7.7
Identities = 13/27 (48%), Positives = 16/27 (59%)
Frame = -3

Query: 262 FRYKHCNGKKGSVEGVGKRDSAHIHAN 182
FR K CNG G +G GKR S + A+
Sbjct: 216 FRTKSCNGGSGGGDGTGKRPSGDLAAS 242


tr_hit_id Q5SMJ4
Definition tr|Q5SMJ4|Q5SMJ4_ORYSJ Epstein-Barr virus EBNA-1-like OS=Oryza sativa subsp. japonica
Align length 44
Score (bit) 35.0
E-value 2.6
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP914216|Adiantum capillus-veneris mRNA, clone:
YMU001_000056_D06.
(549 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

tr|Q5SMJ4|Q5SMJ4_ORYSJ Epstein-Barr virus EBNA-1-like OS=Oryza s... 35 2.6

>tr|Q5SMJ4|Q5SMJ4_ORYSJ Epstein-Barr virus EBNA-1-like OS=Oryza
sativa subsp. japonica GN=OSJNBb0019L07.13 PE=4 SV=1
Length = 172

Score = 35.0 bits (79), Expect = 2.6
Identities = 14/44 (31%), Positives = 24/44 (54%)
Frame = -3

Query: 247 CNGKKGSVEGVGKRDSAHIHANPSRNRKSIHRGEERRVEDKKRS 116
CNG++G G + +AH HAN +R ++ GE+ +R+
Sbjct: 37 CNGRRGGWSGAARARAAHAHANTARGKRQRGSGEKGSARRGRRT 80