BP914308 | |
Clone id | YMU001_000057_E01 |
Library | YMU01 |
Length | 499 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000057_E01. |
Accession | BP914308 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL2886Contig1 |
Sequence | GATATCTTGCAGAAAAGGCAAGAGGAAAGCTCCGCCTACAGAAGATTTACTGCTTTACGT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q9H7Z3 |
Definition | sp|Q9H7Z3|CN102_HUMAN UPF0614 protein C14orf102 OS=Homo sapiens |
Align length | 38 |
Score (bit) | 30.4 |
E-value | 4.8 |
Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | B8LR92 |
Definition | tr|B8LR92|B8LR92_PICSI Putative uncharacterized protein OS=Picea sitchensis |
Align length | 70 |
Score (bit) | 95.1 |
E-value | 2.0e-18 |
Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |