| BP914349 | |
| Clone id | YMU001_000057_H08 |
| Library | YMU01 |
| Length | 511 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000057_H08. |
| Accession | BP914349 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | GATCGTGTCGGCCATACAAGCTAAAACTATATACTTCAGTTGTACGAAGAATCTCATCCC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q2JTT0 |
| Definition | sp|Q2JTT0|PSBA2_SYNJA Photosystem Q(B) protein 2 OS=Synechococcus sp. (strain JA-3-3Ab) |
| Align length | 51 |
| Score (bit) | 31.6 |
| E-value | 2.2 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | - |
| Definition | No hits. |
| Align length | - |
| Score (bit) | - |
| E-value | - |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |