| BP914373 | |
| Clone id | YMU001_000058_B10 |
| Library | YMU01 |
| Length | 511 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000058_B10. |
| Accession | BP914373 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | TTACCTCCTTCTCAGCCCTATCAAGCACTTACACAAGCATCAGAGTGCAAGATGTGAGAA |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q5XGU1 |
| Definition | sp|Q5XGU1|TM178_XENLA Transmembrane protein 178 OS=Xenopus laevis |
| Align length | 30 |
| Score (bit) | 30.0 |
| E-value | 6.5 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | B6PIL8 |
| Definition | tr|B6PIL8|B6PIL8_BRAFL Putative uncharacterized protein OS=Branchiostoma floridae |
| Align length | 66 |
| Score (bit) | 33.5 |
| E-value | 6.2 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |