BP914373 | |
Clone id | YMU001_000058_B10 |
Library | YMU01 |
Length | 511 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000058_B10. |
Accession | BP914373 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | TTACCTCCTTCTCAGCCCTATCAAGCACTTACACAAGCATCAGAGTGCAAGATGTGAGAA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q5XGU1 |
Definition | sp|Q5XGU1|TM178_XENLA Transmembrane protein 178 OS=Xenopus laevis |
Align length | 30 |
Score (bit) | 30.0 |
E-value | 6.5 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | B6PIL8 |
Definition | tr|B6PIL8|B6PIL8_BRAFL Putative uncharacterized protein OS=Branchiostoma floridae |
Align length | 66 |
Score (bit) | 33.5 |
E-value | 6.2 |
Report | BLASTX 2.2.19 [Nov-02-2008] |