BP914465 | |
Clone id | YMU001_000059_C01 |
Library | YMU01 |
Length | 374 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000059_C01. |
Accession | BP914465 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL2402Contig1 |
Sequence | CATGTGGGCATATTGGCGCGCCACGTGTGACCTCCTTGCTGACTTGGCCTCGGCCTCCAA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q01728 |
Definition | sp|Q01728|NAC1_RAT Sodium/calcium exchanger 1 OS=Rattus norvegicus |
Align length | 20 |
Score (bit) | 31.6 |
E-value | 1.3 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |