| BP914474 | |
| Clone id | YMU001_000059_C11 |
| Library | YMU01 |
| Length | 492 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000059_C11. |
| Accession | BP914474 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL2234Contig1 |
| Sequence | CATAGACATTGTGGATGGAGATAAACCCACTGCCGAAGAGTTTTTAGAGAATCTATCGAA |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | O95256 |
| Definition | sp|O95256|I18RA_HUMAN Interleukin-18 receptor accessory protein OS=Homo sapiens |
| Align length | 75 |
| Score (bit) | 30.8 |
| E-value | 3.5 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A9NPY3 |
| Definition | tr|A9NPY3|A9NPY3_PICSI Putative uncharacterized protein OS=Picea sitchensis |
| Align length | 43 |
| Score (bit) | 58.9 |
| E-value | 1.0e-07 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |