BP914488 | |
Clone id | YMU001_000059_E01 |
Library | YMU01 |
Length | 492 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000059_E01. |
Accession | BP914488 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL2008Contig1 |
Sequence | CACAATTGGAGGAAAACGGAACAGATGTGAATGAACAGGACATTGGTTGAGTTTCATGGA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | P97772 |
Definition | sp|P97772|GRM1_MOUSE Metabotropic glutamate receptor 1 OS=Mus musculus |
Align length | 28 |
Score (bit) | 30.0 |
E-value | 5.9 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q4Z5E2 |
Definition | tr|Q4Z5E2|Q4Z5E2_PLABE Putative uncharacterized protein (Fragment) OS=Plasmodium berghei |
Align length | 37 |
Score (bit) | 35.0 |
E-value | 1.9 |
Report | BLASTX 2.2.19 [Nov-02-2008] |