| BP914488 | |
| Clone id | YMU001_000059_E01 |
| Library | YMU01 |
| Length | 492 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000059_E01. |
| Accession | BP914488 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL2008Contig1 |
| Sequence | CACAATTGGAGGAAAACGGAACAGATGTGAATGAACAGGACATTGGTTGAGTTTCATGGA |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | P97772 |
| Definition | sp|P97772|GRM1_MOUSE Metabotropic glutamate receptor 1 OS=Mus musculus |
| Align length | 28 |
| Score (bit) | 30.0 |
| E-value | 5.9 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | Q4Z5E2 |
| Definition | tr|Q4Z5E2|Q4Z5E2_PLABE Putative uncharacterized protein (Fragment) OS=Plasmodium berghei |
| Align length | 37 |
| Score (bit) | 35.0 |
| E-value | 1.9 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |