| BP914575 | |
| Clone id | YMU001_000060_E08 |
| Library | YMU01 |
| Length | 281 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000060_E08. |
| Accession | BP914575 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | AAAGTTCAGTTTTCAAAGGGAAAGGTCTGGATGCCTTTGTGCGCAGATATAAGGAGTCTG |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q8GZA8 |
| Definition | sp|Q8GZA8|ULT1_ARATH Protein ULTRAPETALA 1 OS=Arabidopsis thaliana |
| Align length | 53 |
| Score (bit) | 45.1 |
| E-value | 0.0001 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | Q0V807 |
| Definition | tr|Q0V807|Q0V807_ARATH At4g28190 OS=Arabidopsis thaliana |
| Align length | 53 |
| Score (bit) | 45.1 |
| E-value | 0.002 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |